Never underestimate the amount of Coca-Cola 600 lb shaquisha can drink
https://www.dailymail.com/yourmoney/article-15848781/California-Coca-Cola-plant-closing-century-Americans-turn-noses-soda.html
Never underestimate the amount of Coca-Cola 600 lb shaquisha can drink
https://www.dailymail.com/yourmoney/article-15848781/California-Coca-Cola-plant-closing-century-Americans-turn-noses-soda.html
Tulsi gabbard has announced her resignation today and it's a big deal. A lot of us saw this coming Trump's war adventurism in the Middle East finally pushed her beyond of course she does have a fantastic excuse her husband's bone cancer diagnosis but one wonders if it is a just a reason to get out now as well. Regardless of Tulsi, Trump has lost maga forever one of the main principles of Mecca was no foreign wars and Trump got entangled in Ukraine continuing to send weapons and billions of dollars worse he sent Jared kushner a Jew on the negotiating squad with Iran how ridiculous is that. Escalating around to the point where there was no way out and you know Tulsi gave a statement that Iran was far from having a nuclear weapon Trump instead decided to listen to BB netanyahu and Israel and follow them into war needlessly stupidly and pathetically. Now Trump has created a mess on so many fronts. Principally his overspending now on a war footing has no hope of ever getting back to reality putting the very dollar reserve status at risk threatening massive stagflation the complete impoverishment of the middle class and along with that home buyers have now waited a long four years to get into the market with interest rates still being too high with no chance to go down Trump and may think he can just command the new president of the Fed cut rates but cutting rates when everyone is selling t bills will simply cause runaway inflation like we've never seen before. The only course of action is to cut 30% from the budget they can start by limiting welfare to just two years for all the 600 lb shaquishas and shaquanchas with eight babies from 12 baby daddies. They also need to redefine section 8 housing not as full houses and normal apartments no they should be ramshackle shacks 400 ft or less and I don't care how many babies you've got being poor should not be a luxury being poor should suck enough that you will gladly go get to work and be happy to have a job instead we hear convention about not being able to buy Doritos anymore. Trump is most likely hit around again with a super stopping of missiles the likes of which has never been seen before this will prompt civilian casualties which will turn the population against the USA and for the Muslim extremists so that doesn't work either. There is no military large enough to actually invade on the ground. Walking away means allowing Iran to suddenly take control of the straight four moves and charge passage fees. That gives them more money for their radical groups abroad as well as power. And worse it'll be the biggest humiliating defeat since Biden tried to withdraw from Afghanistan in a mad farce Mass before that the withdrawal from Hanoi. Trump got bloodlust after the success with Maduro and now he has doubled into a game much bigger than he can comprehend No Way out no way for success no way to negotiate no way to walk away and meanwhile his cabinet members will continue to fall off not wanting to be associated with the mess that remains another long-term grinding war that we cannot afford we don't even have the missiles to do so much of our weaponry is obsolete aircraft carriers really for every stealth bomber Iran creates 400,000 attack drones. The age of maga it's over we are now in the age of claw that you can get from a collapsing society before the hard collapse hits
One thing that I've noticed is that if a negro does find a Caucasian female psychotic and stupid enough to date them they will immediately adopt the this is my property posture which is to say costly having an arm flown over their shoulder. It is a kind of Hoarders don't take this from me position and it is extremely gross to see it in action.
I've never seen Caucasians behave in this way except perhaps in high school clearly it is a developmental disorder.
There's a very clear notion of black males invading the space of white females and with laser focus glowing on to them refusing to move until it's gone thousands of times past credulity and normalcy let me explain two times I saw such behavior.
The first was the case of a coffee shop and a nice young blonde female was giving chair massages trying to make a buck the chair massage was facing the window. A large negro welfare man who did not buy a coffee pulled a chair over and sat directly in front of the massage chair learing at the woman his hand on his penis. She was required to finish the half hour chair massage and he just sat there the whole time. I looked around where were the men? This was California there were no testosterone filled men anywhere to be seen none at all it was shocking. In my day four or five properly muscled then would have grabbed him by the scruff thrown him in the streets and if he resisted beating the living crap out of them. But not in today's castrated society which exists in red States oh sorry I guess the Republicans are red now when I grow up it was a communist that were always the red ones forgive me.
The second one I saw gross me out much worse I was in the woman's pedicure parlor at the airport and I sat down and I was giving a basic massage and pedicure. The most disgusting negro sat down in the chair two chairs over from me dear God if they had sent next to me the recon stench of it would have made me vomit. To proceeded to take off his shoes and is absolutely disgusting filthy feet jammed out the poor tiny Asian woman was forced to give him a regular pedicure. Does he not have any clue at all that this is not a treatment that men get no he was there to be a sexual predator and he was loving it he was loving every bit of attention he literally put his arms back behind his head elbow spread wide as if he were a king and she wore his subject and it was obvious he was treating her like s*** as well I almost punched him almost. What are the rules for such places? It reminds me of the transvestite going into the waxing salon and demanding their clitoris get waxed the salon owner says that's not a clitoris that's a penis and then the transvestite sues the salon and shuts them down. Unacceptable behavior needs to be nipped in the bud that's why letting negroes out for shoplifting just leads to insane levels of shoplifting and then murders and drugs and gang wars and gun wars there should be a law that if you have committed your first crime of shoplifting you're given a mandatory one week in prison sentence and they find a particularly hard cramped tiny cell to slam you in for a week with a buzzing fluorescent light on Non-Stop and the rations consist of gloppy cold oatmeal. That may wake them up but they also may be too Simeon to have a brain capable of understanding reward and negative enforcement. They literally live only in the absolute now like a goldfish. I'm afraid until we make giant industrial blenders to reduce them to dog food no wait I wouldn't feed that to a dog pig food there really is no solution. We could ship them all violently over to Liberia or like Lincoln's plan that may actually make the most sense we did found the nation we should have still the rights to put our planned people there. But when the blacks arrived even with four accompaniments of Marines piles of food tools and shovels all they did was huddle together in the dark screaming of fright begging to come back home they build absolutely nothing which is what they always do.
On Monday, MS NOW host Katy Tur moderated a panel in which she discussed recent, supposedly controversial comments by Speaker of the House Mike Johnson, R-La.
“What about this passage from Mike Johnson declaring that our rights do not derive from government, they come from you, our Creator and heavenly father. Is this him putting God over the Declaration of Independence?” she asked incredulously.
I’m just going to pause here and quote from this obscure line in the Declaration of Independence. And by obscure, I mean one of the most famous lines in the English language.
“We hold these truths to be self-evident that all men are created equal… ” maybe Tur never got past that part, “that they are endowed by their Creator with certain unalienable Rights, that among these are Life, Liberty, and the pursuit of Happiness.”
So, the concept that God is “above” the Declaration of Independence is… in the Declaration of Independence. God’s law supersedes man’s law. Governments that deprive citizens of rights endowed by their creator without due process are bad governments and are possibly illegitimate. That’s the whole point of the thing, right?
One of Tur’s guests, Atlantic writer McKay Coppins, actually managed to answer her question with a straight face but with an acknowledgement that her audience may remarkably not be familiar with the concept of God-given rights.
“You know, I think that idea is not wholly uncommon, the idea that we sort of have unalienable rights that come from God can be read in a fairly benign way,” Coppins responded. “Which is basically that we have innate human rights, that our constitution and our government, our democratic government, are meant to codify. Right. That idea is not totally abnormal.”
You don’t say.
God talk is SO foreign to MS NOW. Katy Tur: What about this passage from Mike Johnson declaring that our rights do not derive from government? They come from you, our creator and heavenly father. Is this him putting God over the Declaration of Independence?
McKay Coppins: I… pic.twitter.com/sfpykN5bYc
— Tim Graham (@TimJGraham) May 18, 2026
Somehow this isn’t even the first time an MS NOW host or guest has expressed shock at the concept of rights being endowed by a creator.
In 2024, the now former Politico journalist Heidi Przybyla went on the network and said that the only people who believe in “God-given rights” that don’t come from the government are “Christian Nationalists,” whom she distinguished from other “Christians.”
At least Przybyla later sort of apologized for these remarks, calling them “clumsy.”
Saying that rights come from our creator should be one of the most noncontroversial statements an American could make, a concept universally understood by anyone with a basic understanding of our history.
Unfortunately, it’s not as universal as it once was.
Johnson weighed in on Tur’s comments, saying in an interview with Townhall Editor Larry O’Connor that it was “stunning” she didn’t know the concept of God-given rights was in the declaration.
The speaker of the House said that it was incredible that “someone who is in the mainstream media, on TV every night espousing her views … does not understand the birth document of the country.”
BOOM: @SpeakerJohnson TAKES DOWN Katy Tur…
"This is the MSNBC clip to end all MSNBC clips!"
"To someone who in IN the mainstream media, on TV every night, espousing your views who does NOT understand the birth document of the country…it's incredible!"@LarryOConnor: "You… https://t.co/qbXdKox0Nl pic.twitter.com/JUeCSaaiUU
— Townhall.com (@townhallcom) May 20, 2026
It is stunning, but it is not surprising in my mind.
I was reading one of the pro Holocaust sites supposedly are with hard facts to support the Holocaust and I was particularly interested in their discussion of Auschwitz which we know is a post-war reconstruction. One of the facts they use to prove that there was a gas chamber there was that there was an order for several gas tight doors. These were different from the delousing doors although they don't present clear enough documentation to tell. Instead the author comes up with a Gambit, arguing that wooden gas chamber doors lined with felts and steel springs can also be gas tight. So contrary to all the claims that there were weak non-gastite doors on the supposed gas chamber at Auschwitz that in fact the system would work.
The normal idiot stops there. They think ha gotcha! But the truth is deeper. So I set about finding pictures of the wooden doors of the supposed gas chamber. It was as they said there was felt all around the edges. But it was much more as if one were insulating from the cold not at all like something one would need for a dangerous gas. Then it occurred to me there was nothing at the bottom of the door. No felt, worse and enormous Gap that would have let something I guess it's spew forth killing everyone outside. This is ridiculous I thought how could they possibly be defending this door.
I recall watching a YouTube video of another debunking of a gas chamber elsewhere was it so be more I forget in the pro Holocaust video they showed a very strong gas chamber door that looked correct and then the gas chamber. Some intrepid person actually went there and films continuously so you could see it was not edited the fact that the Strong gas chamber door was nowhere near the gas chamber they were completely disconnected. Once again they were using lies and deception thinking they could fool people because people wanted to believe especially the Jewish people I gather that all of this is just historical revisionism denialism and full of lies. Their wish to obtain that belief stops them from any scientific inquiry although one wonders if they had scientific minds from the beginning or not.
Anyways I leave it to you take a look at the wooden door look at the bottom of the door specifically and you tell me whether or not you would feel safe standing on the other side with the room pressurized with cyanide gas.
https://furtherglory.wordpress.com/wp-content/uploads/2016/05/airraiddoor2.jpg?w=375&h=504
Furthermore it goes on to show an actual order for crematorium ovens. But this doesn't support anything except that they are had people dying presumably from typhus which was the big outbreak at the time. Yet they shake it in front of your face and go see see it's all real we've got the receipts it proves nothing.
Another change is still often say that they were intentionally starved and worked to death. This is just proven as Hitler himself issued an order stating that everyone was to receive a minimum of 2,000 calories a day after hearing of appalling conditions in one of the camps. Furthermore people got camp script which they could use to buy things like chocolate bars and cigarettes. But here's the important part. The Allies Bombed the train supply lines tossing all of Germany into starvation not just people in camps. And in the final days the people running the camps fled trying to escape the rapidly approaching troops leaving no one to feed the prisoners. These two facts alone would account for the starved bodies that people saw upon entering. It is very much in the leftist mind to argue that they understand the intent in the mind of someone else as a crime in this case they argue that it was clearly the intent to produce horrifying starvation in the German mind however stories tell differently stories speak of soccer games between guards and prisoners stories tell of orchestras and plays and swimming pools all to keep the interred people happy just as us had done with its Japanese interred prisoners in world war II in fact one could make a strong case an argument that the Germans treated them better then the US treated the Japanese who did not have such interesting options for arts and theater and music.
We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
The ExposeHome
Friday, May 15th, 2026
Search for...
Search...
Home
We Need Your Support
My Account
About us
Contact us
Please follow & like us :)
Follow by EmailGETTRTruth SocialX (Twitter)
fb-share-icon
GABTelegramInstagramTumblrBlueskyMastodonRSS
Language
enruzh-CNdenlesitfr
English
Search
Search for...
Search...
Support The Exposé
Donate or Subscribe
Categories
Breaking News
Did You Know?
Latest News
Opinion Pages
The Expose Blog
UK News
Uncategorized
US News
World News
Archives
Archives
Select Month
Breaking News
Opinion Page – Where’s the evidence that Covid exists?
By The Exposé on November 23, 2020 • ( Leave a comment )
Listen
Please share our story!
Print 🖨
PDF 📄
COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
IDENTIFICATION OF WHAT EXACTLY?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.
The WHO’s Laboratory testing guidance states:
The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:
The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC “infected” various cells with the novel virus they noted the following:
We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]…No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
Noting this problem, a team of Polish scientists introduced this sequenced “virus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:
“We did not observe any release of the virus from the basolateral side of the HAE culture.”
Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.
It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
VOYAGE OF DISCOVERY
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unknown origin.”
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
ISOLATE NOTHING
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:
“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”
This explains why the Australian government state:
The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:
…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
TESTING FOR NOTHING
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.
While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.
Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state:
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The t
What's the first time watching iRobot because I'm so horribly bored it's a terrible movie it doesn't follow the book whatsoever with commentators are so dumb they can't follow the dialogue they don't know what's being said and neither have they ever heard of Hansel and Gretel I take my hand and pounded into my forehead
But I'm watching an old movie from college Excalibur and there are two females commenting mostly talking about hairstyles and how people are rude in the dark ages that it's offending their sense of civility and comfort which is totally stupid to talk about then the screen flashes and shows a millipede and the woman says and I kid you not I hate centipedes okay so she doesn't know anything about biology then the other one says I'm still trying to figure out if Merlin is Obi-Wan now I can't even begin to think of all the wires that are short circuited in her head to come up with a statement like that all I know is I dread the world outside I despise other humans and I hate my nation for destroying the lives of a brilliant engineers importing millions of low IQ savages from India in a form of anti white genocide and I don't know exactly who's behind it all but certainly the few diet tribes I've heard and support of such things have come from Jewish people in Europe power people people with big money and mansions bigger than I can conceive of.
We spend a billion dollars on a sports stadium and that comes out of regular poor People's taxes even though the owners of the sports company are billionaires it frees up hundreds of million dollars so they can pay their players salaries like 50 million dollars a year. Meanwhile where are the stadiums to invention progress centers for inventors and geniuses so that they can get paid $50 million dollars a year have easy cheap access to vessel printing digital fabrication and materials of all kind why don't those centers exist because America is somehow taken a shift to financialization rather than invention even Elon musk who everyone exclaims is such a genius actually is not an inventor father was Steve jobs. They are just show men. If you aren't already connected with lots of money with family and relations and connections with people who are already wealthy it's nearly impossible to start a company today that's innovation stagnates we haven't really improved much since the 1950s if anything our people are substantially dumber being able to do advanced algebra on first year calculus was a no-brainer for a large part of the population before they ever went to college today they can't tell you how many sides of triangle has or what oceans surround America they can't name a country in Africa you may as well forget knowing anything about philosophy or deep science the whole thing fills me with a sense of disgust and horror it foretells the other collapse of our nation you can only drive packaging things and financializing for so long with so much money printing America is in the business of war as best I can tell it is the one thing we still do well.
Something has to give. More dams make no sense when the rivers are already running dry. More pumped wells make no sense when there is no water left to tap. They just hasten water bankruptcy.
Politically, the country’s ambition for food security through self-reliance needs to be rethought, hydrologists say. There is simply not enough water to achieve it in the long run. Madani and others call for farmers to switch from growing thirsty staple crops such as rice to higher-value, less water-intensive crops that can be sold internationally in exchange for staples. But that requires Iran to lose its current political status as an international pariah and rejoin the global trading community.
the sentence was reduced after forensic psychiatric experts found that he had a mild intellectual disability. One assessment estimated his IQ at 41, although a later report put it in the range of 64 to 75.
The court treated his condition as a mitigating factor and said that, despite being 19 years and 8 months old at the time of the offense, his developmental level could be considered comparable to that of the 13-year-old victim.
The judgment, cited by Utenfilter, said, “In mitigation, the court finds that it must be emphasized that the defendant is most likely no further along in development than the victim, and that he appears to have a reduced understanding of reality.”
However that is normal for Africans so do we let all Africans rape 13 and 10 year old girls and get that out with no punishment whatsoever simply because they are a unevolved divergent race closer to apes than human I guess we do. They are applying the rules for Caucasian people to the African genome you cannot do that it is based on the leftist notion that all of the races are equal when in fact the African race is a million years behind in evolution it has a smaller brain higher violence primitive incapable of complex thinking and simply becomes a horror nightmare for any Nations stupid enough to let them in recently we heard from Spain making the same argument that these low IQ Savage primates were equivalent of Spanish people many of whom are European blooded Caucasian they are not at all the same they will find out in time as all nations that commit this horror to. The USA had a plan to relocate all of its negroes to Liberia that is what Abraham Lincoln wanted to do but even giving them supplies and dozens of marine guards the Africans would only sit around and fight and starve they could not build anything not even a hot in the end they all beg to come back to the USA the USA should never have listened it should have simply kept depositing them and let evolution decide who lives and dies it sounds tragic but what have we wrought by not removing them from our society the cost is in the tens of trillions it is held our entire nation back it has raped our people it has punched our grandmothers in the face it has murdered millions for no reason whatsoever it has turned our 20 largest cities into horrific jungles of violence and horror all because Lincoln was assassinated and his plan to remove the Africans from America was undone what a disaster all I can say is it is not too late maybe not for all of America but at least should we not have some sane states that are not part of this horror if nothing else make the punishment for these crimes very high but that doesn't help either because financially then we are paying 70,000 a year to keep them in prison and a bankrupts US anyways perhaps if we had large industrial blenders they could all be tossed into and then fed to cows I don't know there has to be a solution somehow we could certainly take over Cuba and make it a Caucasian only society if you haven't looked at Cuba you would see that it is almost entirely black entirely unique right most of the higher thinking add mixture people's have already left to Florida and every country that does not have billions in oil wealth they fall into the deepest horrors of poverty and violence like Haiti. Haiti is such a brilliant example for us to learn from there is literally just a line drawn down the middle and the Dominican Republic is on one side and Haiti is on the other. But what one notices is that the Dominican Republic is green it has trees and buildings because they are Arab or half negroid. But the Haitians are full negroid and their lands look just like the s*** lands in India and Pakistan where there are no trees it's all dirt everything has been destroyed even in South Africa the roads themselves that the Caucasians left for the negroes have been ripped up and destroyed there can be nothing left and now we see that in San Jose where they are stealing all of the copper wire from Street lamps so that now we no longer have functioning Street lamps across large parts of that City and across the all black Oakland. To speak the truth it's not racism racism would require that something be wrong and incorrect fact this is simply reality slapping Us in the face over and over again wondering when the dumb people will wake up.
Declares we have a fragrant violation. The word is flagrant.
https://m.youtube.com/watch?v=YWgl-wh3My8
At the same time ilhan Omar announces world war eleven.
The dumb ruled by the dumb the news given out by the dumb